chipseq-sr/main
View on GitHub
Download RO-Crate
Run on GalaxyComplete ChIP-seq analysis for single-end sequencing data. Processes raw FASTQ files through adapter removal (fastp), alignment to reference genome (Bowtie2), and quality filtering (MAPQ greater than 30). Peak calling with MACS2 uses a fixed extension of 200bp to identify protein-DNA binding sites. Generates alignment files, coverage, peak calls, and quality metrics for downstream analysis.
Inputs
| ID | Name | Description | Type |
|---|---|---|---|
| Adapter sequence | #main/Adapter sequence | You can decide to leave it empty for an automatic detection or - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
|
| Effective genome size | #main/Effective genome size | Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000 |
|
| Normalize profile | #main/Normalize profile | Whether you want to have a profile normalized as Signal to Million Reads |
|
| Percentage of bad quality bases per read | #main/Percentage of bad quality bases per read | fastp will discard any read which has more than this percentage of bases with a quality below 30, use 100 to not filter reads based on quality. We recommend to use a value that corresponds approximately to 15bp of good quality (for 100bp reads use 85, for 50bp use 70) |
|
| Reference genome | #main/Reference genome | Choose a reference genome to map on |
|
| SR fastq input | #main/SR fastq input | Should be a collection with ChIPseq fastqs |
|
Steps
| ID | Name | Description |
|---|---|---|
| 6 | Fastp (remove adapter and bad quality reads) | toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.0.1+galaxy2 |
| 7 | Bowtie2 map on reference | toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.4+galaxy0 |
| 8 | filter MAPQ30 | toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1 |
| 9 | Call Peaks with MACS2 | toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0 |
| 10 | summary of MACS2 | summary of MACS2 toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2 |
| 11 | Bigwig from MACS2 | wig_to_bigWig |
| 12 | MultiQC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3 |
Outputs
| ID | Name | Description | Type |
|---|---|---|---|
| MACS2 narrowPeak | #main/MACS2 narrowPeak | n/a |
|
| MACS2 peaks | #main/MACS2 peaks | n/a |
|
| MACS2 report | #main/MACS2 report | n/a |
|
| MACS2 summits | #main/MACS2 summits | n/a |
|
| MultiQC on input dataset(s): Stats | #main/MultiQC on input dataset(s): Stats | n/a |
|
| MultiQC webpage | #main/MultiQC webpage | n/a |
|
| coverage from MACS2 | #main/coverage from MACS2 | n/a |
|
| filtered BAM | #main/filtered BAM | n/a |
|
| mapping stats | #main/mapping stats | n/a |
|
Version History
v0.1 (earliest) Created 21st Oct 2022 at 03:01 by WorkflowHub Bot
Updated to v0.1
Frozen
v0.18963174
Creators and Submitter
Views: 15133 Downloads: 13971 Runs: 0
Created: 21st Oct 2022 at 03:01
Last updated: 20th Aug 2025 at 10:23
Tags AttributionsNone
Related items
Galaxy is an open, web-based platform for accessible, reproducible, and transparent computational biological research.
- Accessible: Users can easily run tools without writing code or using the CLI; all via a user-friendly web interface.
- Reproducible: Galaxy captures all the metadata from an analysis, making it completely reproducible.
- Transparent: Users share and publish analyses via interactive pages that can enhance analyses with user annotations.
- Scalable: Galaxy can run ...
Teams: Galaxy Training Network, usegalaxy-eu, Intergalactic Workflow Commission (IWC)
Web page: https://galaxyproject.org/
The Intergalactic Workflow Commission releases vetted analysis pipelines for the Galaxy platform.
You can contribute too!
Space: Galaxy
Public web page: https://iwc.galaxyproject.org/
