Workflow Type: Galaxy

Complete ChIP-seq analysis for single-end sequencing data. Processes raw FASTQ files through adapter removal (fastp), alignment to reference genome (Bowtie2), and quality filtering (MAPQ greater than 30). Peak calling with MACS2 uses a fixed extension of 200bp to identify protein-DNA binding sites. Generates alignment files, coverage, peak calls, and quality metrics for downstream analysis.

Inputs

ID Name Description Type
Adapter sequence #main/Adapter sequence You can decide to leave it empty for an automatic detection or - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TruSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
Effective genome size #main/Effective genome size Used by MACS2: H. sapiens: 2700000000, M. musculus: 1870000000, D. melanogaster: 120000000, C. elegans: 90000000
  • int
Normalize profile #main/Normalize profile Whether you want to have a profile normalized as Signal to Million Reads
  • boolean
Percentage of bad quality bases per read #main/Percentage of bad quality bases per read fastp will discard any read which has more than this percentage of bases with a quality below 30, use 100 to not filter reads based on quality. We recommend to use a value that corresponds approximately to 15bp of good quality (for 100bp reads use 85, for 50bp use 70)
  • int
Reference genome #main/Reference genome Choose a reference genome to map on
  • string
SR fastq input #main/SR fastq input Should be a collection with ChIPseq fastqs
  • array containing
    • File

Steps

ID Name Description
6 Fastp (remove adapter and bad quality reads) toolshed.g2.bx.psu.edu/repos/iuc/fastp/fastp/1.0.1+galaxy2
7 Bowtie2 map on reference toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.4+galaxy0
8 filter MAPQ30 toolshed.g2.bx.psu.edu/repos/devteam/samtool_filter2/samtool_filter2/1.8+galaxy1
9 Call Peaks with MACS2 toolshed.g2.bx.psu.edu/repos/iuc/macs2/macs2_callpeak/2.2.9.1+galaxy0
10 summary of MACS2 summary of MACS2 toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_grep_tool/9.5+galaxy2
11 Bigwig from MACS2 wig_to_bigWig
12 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.27+galaxy3

Outputs

ID Name Description Type
MACS2 narrowPeak #main/MACS2 narrowPeak n/a
  • File
MACS2 peaks #main/MACS2 peaks n/a
  • File
MACS2 report #main/MACS2 report n/a
  • File
MACS2 summits #main/MACS2 summits n/a
  • File
MultiQC on input dataset(s): Stats #main/MultiQC on input dataset(s): Stats n/a
  • File
MultiQC webpage #main/MultiQC webpage n/a
  • File
coverage from MACS2 #main/coverage from MACS2 n/a
  • File
filtered BAM #main/filtered BAM n/a
  • File
mapping stats #main/mapping stats n/a
  • File

Version History

v1.0 (latest) Created 4th Nov 2025 at 03:01 by WorkflowHub Bot

Updated to v1.0


Frozen v1.0 4020806

v0.15 Created 31st Jul 2025 at 03:02 by WorkflowHub Bot

Updated to v0.15


Frozen v0.15 fad5aba

v0.14 Created 26th Mar 2025 at 09:52 by WorkflowHub Bot

Updated to v0.14


Frozen v0.14 64f1c18

v0.13 Created 7th Feb 2025 at 03:02 by WorkflowHub Bot

Updated to v0.13


Frozen v0.13 7060e93

v0.12 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.12


Frozen v0.12 7605642

v0.8 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 1d6df89

v0.7 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 cb80ed9

v0.6 Created 7th Oct 2024 at 16:33 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 835ae56

v0.11 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.11


Frozen v0.11 dada755

v0.10 Created 30th May 2024 at 11:35 by WorkflowHub Bot

Updated to v0.10


Frozen v0.10 0a16026

v0.9 Created 30th Apr 2024 at 03:02 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 924fbb6

v0.5 Created 18th Oct 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 56e6f3b

v0.4 Created 1st Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 1a21f69

v0.3 Created 14th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.3


Frozen v0.3 906ba40

v0.2 Created 29th Nov 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 97c1b8e

v0.1 (earliest) Created 21st Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 8963174
help Creators and Submitter
Creator
  • Lucille Delisle
Submitter
Activity

Views: 14878   Downloads: 13787   Runs: 0

Created: 21st Oct 2022 at 03:01

Last updated: 20th Aug 2025 at 10:23

help Tags
help Attributions

None

Total size: 48 KB
Powered by
(v.1.17.1)
Copyright © 2008 - 2025 The University of Manchester and HITS gGmbH