rnaseq-sr/main
View on GitHub
Download RO-Crate
Run on Galaxy
Tests This workflow takes as input a list of single-reads fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.
Inputs
| ID | Name | Description | Type |
|---|---|---|---|
| SR fastq input | SR fastq input | Should be a list of single-read RNA-seq fastqs |
|
| cufflinks_FPKM | cufflinks_FPKM | Whether FPKM values should be computed with cufflinks |
|
| forward_adapter | forward_adapter | Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC |
|
| gtf | gtf | gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming |
|
| gtf with regions to exclude from FPKM normalization with Cufflinks | gtf with regions to exclude from FPKM normalization with Cufflinks | Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse |
|
| reference_genome | reference_genome | reference_genome |
|
| strandedness | strandedness | For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence |
|
| stringtie_FPKM | stringtie_FPKM | Whether FPKM values should be computed with StringTie |
|
Steps
| ID | Name | Description |
|---|---|---|
| 8 | Cutadapt (remove adapter + bad quality bases) | toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.9+galaxy1 |
| 9 | get reference_genome as text parameter | toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1 |
| 10 | awk command from strand | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 11 | Get cufflinks strandess parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 12 | Get Stringtie strandedness parameter | toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0 |
| 13 | STAR: map and count and coverage splitted | toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy1 |
| 14 | MultiQC | toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.24.1+galaxy0 |
| 15 | Get Uniquely mapped unstranded coverage | n/a |
| 16 | Re-arrange Stranded RNA-seq coverage | n/a |
| 17 | Compute FPKM with cufflinks | toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3 |
| 18 | Extract gene counts | toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy1 |
| 19 | Compute FPKM with StringTie | toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.3+galaxy0 |
Outputs
| ID | Name | Description | Type |
|---|---|---|---|
| output_log | output_log | n/a |
|
| reads_per_gene from STAR | reads_per_gene from STAR | n/a |
|
| mapped-reads | mapped-reads | n/a |
|
| MultiQC webpage | MultiQC webpage | n/a |
|
| MultiQC on input dataset(s): Stats | MultiQC on input dataset(s): Stats | n/a |
|
| both strands coverage | both strands coverage | n/a |
|
| stranded coverage | stranded coverage | n/a |
|
| genes_expression_cufflinks | genes_expression_cufflinks | n/a |
|
| transcripts_expression_cufflinks | transcripts_expression_cufflinks | n/a |
|
| HTS count like output | HTS count like output | n/a |
|
| genes_expression_stringtie | genes_expression_stringtie | n/a |
|
Version History
v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot
Updated to v0.1
Frozen
v0.130a19f3
Creators and Submitter
Views: 4696 Downloads: 1023 Runs: 0
Created: 22nd Oct 2022 at 03:01
Last updated: 17th Jan 2023 at 03:01
Tags AttributionsNone
Related items
IWC - Intergalactic Workflow Commission
Space: This Team is not associated with a Space
Public web page: https://github.com/galaxyproject/iwc
