Workflow Type: Galaxy

This workflow takes as input a list of single-reads fastqs. Adapters and bad quality bases are removed with cutadapt. Reads are mapped with STAR with ENCODE parameters and genes are counted simultaneously as well as normalized coverage (per million mapped reads) on uniquely mapped reads. The counts are reprocessed to be similar to HTSeq-count output. FPKM are computed with cufflinks and/or with StringTie. The unstranded normalized coverage is computed with bedtools.

Inputs

ID Name Description Type
SR fastq input SR fastq input Should be a list of single-read RNA-seq fastqs
  • File[]
cufflinks_FPKM cufflinks_FPKM Whether FPKM values should be computed with cufflinks
  • boolean
forward_adapter forward_adapter Please use: For R1: - For Nextera: CTGTCTCTTATACACATCTCCGAGCCCACGAGAC - For TrueSeq: GATCGGAAGAGCACACGTCTGAACTCCAGTCAC or AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
  • string
gtf gtf gtf compatible with the reference_genome. Mind the UCSC/Ensembl differences in chromosome naming
  • File
gtf with regions to exclude from FPKM normalization with Cufflinks gtf with regions to exclude from FPKM normalization with Cufflinks Could be a gtf with for example one entry for the chrM forward and one entry for the chrM reverse
  • File?
reference_genome reference_genome reference_genome
  • string
strandedness strandedness For stranded RNA, reverse means that the read is complementary to the coding sequence, forward means that the read is in the same orientation as the coding sequence
  • string
stringtie_FPKM stringtie_FPKM Whether FPKM values should be computed with StringTie
  • boolean

Steps

ID Name Description
8 Cutadapt (remove adapter + bad quality bases) toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/4.6+galaxy1
9 get reference_genome as text parameter toolshed.g2.bx.psu.edu/repos/iuc/compose_text_param/compose_text_param/0.1.1
10 awk command from strand toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
11 Get cufflinks strandess parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
12 Get Stringtie strandedness parameter toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0
13 STAR: map and count and coverage splitted toolshed.g2.bx.psu.edu/repos/iuc/rgrnastar/rna_star/2.7.11a+galaxy0
14 MultiQC toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.11+galaxy1
15 Get Uniquely mapped unstranded coverage n/a
16 Re-arrange Stranded RNA-seq coverage n/a
17 Compute FPKM with cufflinks toolshed.g2.bx.psu.edu/repos/devteam/cufflinks/cufflinks/2.2.1.3
18 Extract gene counts toolshed.g2.bx.psu.edu/repos/bgruening/text_processing/tp_awk_tool/9.3+galaxy0
19 Compute FPKM with StringTie toolshed.g2.bx.psu.edu/repos/iuc/stringtie/stringtie/2.2.1+galaxy1

Outputs

ID Name Description Type
output_log output_log n/a
  • File
reads_per_gene from STAR reads_per_gene from STAR n/a
  • File
mapped-reads mapped-reads n/a
  • File
MultiQC on input dataset(s): Stats MultiQC on input dataset(s): Stats n/a
  • File
MultiQC webpage MultiQC webpage n/a
  • File
both strands coverage both strands coverage n/a
  • File
stranded coverage stranded coverage n/a
  • File
transcripts_expression_cufflinks transcripts_expression_cufflinks n/a
  • File
genes_expression_cufflinks genes_expression_cufflinks n/a
  • File
HTS count like output HTS count like output n/a
  • File
genes_expression_stringtie genes_expression_stringtie n/a
  • File

Version History

v1.2 (latest) Created 29th Jan 2025 at 03:02 by WorkflowHub Bot

Updated to v1.2


Frozen v1.2 4dfaa02

v1.1 Created 26th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.1


Frozen v1.1 49929d3

v1.0 Created 20th Nov 2024 at 03:02 by WorkflowHub Bot

Updated to v1.0


Frozen v1.0 96e4475

v0.9 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.9


Frozen v0.9 26e44e5

v0.6 Created 7th Oct 2024 at 16:32 by WorkflowHub Bot

Updated to v0.6


Frozen v0.6 2465702

v0.8 Created 16th Jul 2024 at 03:02 by WorkflowHub Bot

Updated to v0.8


Frozen v0.8 ee9034e

v0.7 Created 29th Jun 2024 at 03:02 by WorkflowHub Bot

Updated to v0.7


Frozen v0.7 59f2b7e

v0.5 Created 16th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.5


Frozen v0.5 ac353d9

v0.4.1 Created 15th Sep 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4.1


Frozen v0.4.1 5228c14

v0.4 Created 17th Jan 2023 at 03:01 by WorkflowHub Bot

Updated to v0.4


Frozen v0.4 f49c5a7

v0.2 Created 1st Dec 2022 at 03:01 by WorkflowHub Bot

Updated to v0.2


Frozen v0.2 28b9493

v0.1 (earliest) Created 22nd Oct 2022 at 03:01 by WorkflowHub Bot

Updated to v0.1


Frozen v0.1 30a19f3
help Creators and Submitter
Creator
  • Lucille Delisle
Additional credit

Lucille Delisle

Submitter
Activity

Views: 13309   Downloads: 16222   Runs: 3

Created: 22nd Oct 2022 at 03:01

Last updated: 17th Jan 2023 at 03:01

help Tags
help Attributions

None

Total size: 100 KB
Powered by
(v.1.17.1)
Copyright © 2008 - 2025 The University of Manchester and HITS gGmbH