skim2mito
skim2mito is a snakemake pipeline for the batch assembly, annotation, and phylogenetic analysis of mitochondrial genomes from low coverage genome skims. The pipeline was designed to work with sequence data from museum collections. However, it should also work with genome skims from recently collected samples.
Contents
- Setup
- Example data
- Input
- Output
- Filtering contaminants
- Assembly and annotation only
- Running your own data
- Getting help
- Citations
Setup
The pipeline is written in Snakemake and uses conda to install the necessary tools.
It is strongly recommended to install conda using Mambaforge. See details here https://snakemake.readthedocs.io/en/stable/getting_started/installation.html
Once conda is installed, you can pull the github repo and set up the base conda environment.
# get github repo
git clone https://github.com/o-william-white/skim2mito
# change dir
cd skim2mito
# setup conda env
conda env create -n skim2mito_env -f workflow/envs/conda_env.yaml
conda config --set channel_priority flexible
If you need to install the conda environment to a specific location, use the following example, where the prefix argument can be updated to include a specific path:
conda env create -n skim2mito_env --prefix /your_path/skim2mito_env -f workflow/envs/conda_env.yaml
Example data
Before you run your own data, it is recommended to run the example datasets provided. This will confirm there are no user-specific issues with the setup and it also installs all the dependencies. The example data includes simulated mitochondrial data from 25 different butterfly species.
To run the example data, use the code below. Note that you need to change the user email to your own address. The email is required by the Bio Entrez package to fetch reference sequences. The first time you run the pipeline, it will take some time to install each of the conda environments, so it is a good time to take a tea break :).
conda activate skim2mito_env
snakemake --cores 4 --use-conda --config user_email=user@example_email.com
Once this has finished, you can generate a snakemake report using the following command. As above, you need to change the user email to your own address.
snakemake --cores 4 --use-conda --config user_email=user@example_email.com --report skim2mito_report.html
Input
Snakemake requires a config.yaml
and samples.csv
to define input parameters and sequence data for each sample.
For the example data provided, the config file is located here config/config.yaml
and it looks like this:
# path to sample sheet csv with columns for ID,forward,reverse,taxid,seed,gene
samples: config/samples.csv
# user email
user_email: user@example_email.com
# getorganelle reference (go_fetch, custom)
go_reference: go_fetch
# forward adapter
forward_adapter: AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
# reverse adapter
reverse_adapter: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
# fastp deduplication (True/False)
fastp_dedup: True
# mitos refseq database (refseq39, refseq63f, refseq63m, refseq63o, refseq89f, refseq89m, refseq89o)
mitos_refseq: refseq39
# mito code (2 = Vertebrate, 4 = Mold, 5 = Invertebrate, 9 = Echinoderm, 13 = Ascidian, 14 = Alternative flatworm)
mitos_code: 5
# alignment trimming method to use (gblocks or clipkit)
alignment_trim: gblocks
# alignment missing data threshold for alignment (0.0 - 1.0)
missing_threshold: 0.5
# name of outgroup sample (optional)
# use "NA" if there is no obvious outgroup
# if more than one outgroup use a comma separated list i.e. "sampleA,sampleB"
outgroup: Eurema_blanda
# plot dimensions (cm)
plot_height: 20
plot_width: 20
The example samples.csv file is located here config/samples.csv
and it looks like this (note that the seed and gene columns are only required if the custom getorganelle database option is specified in the config file):
ID | forward | reverse | taxid | seed | gene |
---|---|---|---|---|---|
Adelpha_iphiclus | .test/reads/Adelpha_iphiclus_1.fq.gz | .test/reads/Adelpha_iphiclus_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Anartia_jatrophae_saturata | .test/reads/Anartia_jatrophae_saturata_1.fq.gz | .test/reads/Anartia_jatrophae_saturata_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Araschnia_levana | .test/reads/Araschnia_levana_1.fq.gz | .test/reads/Araschnia_levana_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Auzakia_danava | .test/reads/Auzakia_danava_1.fq.gz | .test/reads/Auzakia_danava_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Baeotus_beotus | .test/reads/Baeotus_beotus_1.fq.gz | .test/reads/Baeotus_beotus_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Catacroptera_cloanthe | .test/reads/Catacroptera_cloanthe_1.fq.gz | .test/reads/Catacroptera_cloanthe_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Chalinga_pratti | .test/reads/Chalinga_pratti_1.fq.gz | .test/reads/Chalinga_pratti_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Diaethria_gabaza_eupepla | .test/reads/Diaethria_gabaza_eupepla_1.fq.gz | .test/reads/Diaethria_gabaza_eupepla_2.fq.gz | 127268 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Doleschallia_melana | .test/reads/Doleschallia_melana_1.fq.gz | .test/reads/Doleschallia_melana_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Eurema_blanda | .test/reads/Eurema_blanda_1.fq.gz | .test/reads/Eurema_blanda_2.fq.gz | 42450 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Hypolimnas_usambara | .test/reads/Hypolimnas_usambara_1.fq.gz | .test/reads/Hypolimnas_usambara_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Junonia_villida | .test/reads/Junonia_villida_1.fq.gz | .test/reads/Junonia_villida_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Kallima_paralekta | .test/reads/Kallima_paralekta_1.fq.gz | .test/reads/Kallima_paralekta_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Kallimoides_rumia | .test/reads/Kallimoides_rumia_1.fq.gz | .test/reads/Kallimoides_rumia_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Litinga_cottini | .test/reads/Litinga_cottini_1.fq.gz | .test/reads/Litinga_cottini_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Mallika_jacksoni | .test/reads/Mallika_jacksoni_1.fq.gz | .test/reads/Mallika_jacksoni_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Moduza_procris | .test/reads/Moduza_procris_1.fq.gz | .test/reads/Moduza_procris_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Parasarpa_zayla | .test/reads/Parasarpa_zayla_1.fq.gz | .test/reads/Parasarpa_zayla_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Phaedyma_columella | .test/reads/Phaedyma_columella_1.fq.gz | .test/reads/Phaedyma_columella_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Precis_pelarga | .test/reads/Precis_pelarga_1.fq.gz | .test/reads/Precis_pelarga_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Protogoniomorpha_temora | .test/reads/Protogoniomorpha_temora_1.fq.gz | .test/reads/Protogoniomorpha_temora_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Salamis_cacta | .test/reads/Salamis_cacta_1.fq.gz | .test/reads/Salamis_cacta_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Smyrna_blomfildia | .test/reads/Smyrna_blomfildia_1.fq.gz | .test/reads/Smyrna_blomfildia_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Tacola_larymna | .test/reads/Tacola_larymna_1.fq.gz | .test/reads/Tacola_larymna_2.fq.gz | 100750 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Yoma_algina | .test/reads/Yoma_algina_1.fq.gz | .test/reads/Yoma_algina_2.fq.gz | 40040 | .test/seed_mitochondrion.fasta | .test/gene_mitochondrion.fasta |
Output
All output files are saved to the results
direcotry. Below is a table summarising all of the output files generated by the pipeline.
Directory | Description |
---|---|
fastqc_raw | Fastqc reports for raw input reads |
fastp | Fastp reports from quality control of raw reads |
fastqc_qc | Fastqc reports for quality controlled reads |
go_fetch | Optional output containing reference databasesused by GetOrganelle |
getorganelle | GetOrganelle output with a directory for each sample |
assembled_sequence | Assembled sequences selected from GetOrganelle output and renamed |
seqkit | Seqkit summary of each assembly |
blastn | Blastn output of each assembly |
minimap | Mapping output of quality filtered reads against each assembly |
blobtools | Blobtools assembly summary collating blastn and mapping output |
assess_assembly | Plots of annotations, mean depth, GC content and proportion mismatches |
annotations | Annotation outputs of mitos |
summary | Summary per sample (seqkit stats), contig (GC content, length, coverage, taxonomy and annotations) and annotated gene counts |
annotated_genes | Unaligned fasta files of annotated genes identified across all samples |
mafft | Mafft aligned fasta files of annotated genes identified across all samples |
mafft_filtered | Mafft aligned fasta files after the removal of sequences based on a missing data threshold |
alignment_trim | Ambiguous parts of alignment removed using either gblocks or clipkit |
iqtree | Iqtree phylogenetic analysis of annotated genes |
plot_tree | Plots of phylogenetic trees |
multiqc | Multiqc summary report |
Filtering contaminants
If you are working with museum collections, it is possible that you may assemble and annotate sequences from contaminant/non-target species. Contaminant sequences can be identified based on the blast search output or unusual placement in the phylogenetic trees (see blobtools and plot_tree outputs).
A supplementary python script format_alignments.py
is provided to remove putative contaminants from alignments, and format the alignments for downstream phylogenetic analysis.
For example, let's say we wanted to remove all sequences from the sample "Kallima_paralekta" and atp6 gene sequences, you could run the script as shown below. The script works by identifying and removing sequences that have names with Kallima_paralekta
or atp6
in the sequence names. The filtered alignments are written to a new output directory filter_alignments_output
.
python workflow/scripts/format_alignments.py \
--input results/mafft_filtered/ \
--cont Kallima_paralekta atp6 \
--output filter_alignments_output
Note that the output fasta files have been reformatted so each alignment file is named after the gene and each sequence is named after the sample. This is useful if you would like to run our related pipeline gene2phylo for further phylogenetic analyses.
Assembly and annotation only
If you are only interested in the assembly of mitochondrial sequences and annotation of genes without the phylogenetic analysis, you can stop the pipeline from running the gene alignment and phylogenetic analyses using the --omit-from
parameter.
snakemake --cores 4 --use-conda --config user_email=user@example_email.com --omit-from mafft
Running your own data
The first thing you need to do is generate your own config.yaml and samples.csv files, using the files provided as a template.
GetOrganelle requires reference data in the format of seed and gene reference fasta files. By default the pipeline uses a basic python script called go_fetch.py https://github.com/o-william-white/go_fetch to download and format reference data formatted for GetOrganelle.
go_fetch.py works by searching NCBI based on the NCBI taxonomy specified by the taxid column in the samples.csv file. Note that the seed and gene columns in the samples.csv file are only required if you want to provide your own custom GetOrganelle seed and gene reference databases.
You can use the default reference data for GetOrganelle, but I would recommend using custom reference databases where possible. See here for details of how to set up your own databases https://github.com/Kinggerm/GetOrganelle/wiki/FAQ#how-to-assemble-a-target-organelle-genome-using-my-own-reference
Getting help
If you have any questions, please do get in touch in the issues or by email o.william.white@gmail.com
Citations
If you use the pipeline, please cite our bioarxiv preprint: https://doi.org/10.1101/2023.08.11.552985
Since the pipeline is a wrapper for several other bioinformatic tools we also ask that you cite the tools used by the pipeline:
- Fastqc https://github.com/s-andrews/FastQC
- Fastp https://doi.org/10.1093/bioinformatics/bty560
- GetOrganelle https://doi.org/10.1186/s13059-020-02154-5
- Blastn https://doi.org/10.1186/1471-2105-10-421
- Minimap2 https://doi.org/10.1093/bioinformatics/bty191
- Blobtools https://doi.org/10.12688/f1000research.12232.1
- Seqkit https://doi.org/10.1371/journal.pone.0163962
- MITOS2 https://doi.org/10.1016/j.ympev.2012.08.023
- Gblocks (default) https://doi.org/10.1093/oxfordjournals.molbev.a026334
- Clipkit (optional) https://doi.org/10.1371/journal.pbio.3001007
- Mafft https://doi.org/10.1093/molbev/mst010
- Iqtree https://doi.org/10.1093/molbev/msu300
- ete3 https://doi.org/10.1093/molbev/msw046
- ggtree https://doi.org/10.1111/2041-210X.12628
- Multiqc https://doi.org/10.1093/bioinformatics/btw354
Version History
main @ a63288c (latest) Created 7th Oct 2024 at 13:24 by Oliver White
Merge pull request #34 from SchistoDan/main
Update go_fetch.py
Frozen
main
a63288c
main @ 34ef5b6 (earliest) Created 12th Mar 2024 at 15:03 by Oliver White
Min version
Frozen
main
34ef5b6

Creators
Not specifiedSubmitter
Views: 2475 Downloads: 647
Created: 12th Mar 2024 at 15:03
Last updated: 7th Oct 2024 at 13:24


None
